DNA sequences alignment

Given two sequences of nucleic acid, we try to align them the best way possible. We can insert any number of gaps in both sequences.

We use the following rules:
- if at a given position the acids are the same, we count +2
- if at a given position the acids are different, we count -1
- if there is a gap in one string, we count -2

For example, consider the two following sequences:

• GAATTCAGTTA
• GGATCGA

The best possible alignment (the one with the greater score) is:

GAATTCAGTTA
GGA-TC-G--A

which gives a score of 3

• G G +2
• A G -1
• A A +2
• T - -2
• T T +2
• C C +2
• A - -2
• G G +2
• T - -2
• T - -2
• A A +2

You are given the 2 following sequences:

'GTAATAGACTCGGAAACGCAACCGTCAGCAAAACGCGTTCGGTCGATCGTAATATGTAAGATCCAATTAGGGCGACCTCTTGTGCGGTCAGTAGGAGTCT' 'ATAACTCTGAATCCCCCGACGTGTCGTGATGGGCGACGGACGGCACCCTTAACGTGATCCTGAACTCCCGTGGGGACCGTTGTCGGTAATGCAGGGTGTG'

What is the score for the best alignment and the number of acids identical in both aligned sequences?

Answer format: comma separated

Example: 3,6 // For the sequences GAATTCAGTTA and GGATCGA

[My timing: < 1 sec]